Table 1

Guide RNA sequences, respective genomic coordinates, target exons referring to transcript variants 5, 6 and 7 of human TP53 and FAM-6-labelled tracr sequence

Guide RNAGenomic coordinates
ID: NG_017013.2
Length (bp)GC (%)Target*Sequence 5’−3’
sgRNA118 311–18 3294148.7Exon 3CUGCAUGGGCGGCAUGAACGUUUUAGAGCUAUGCUGUUUUG
sgRNA217 440–17 4584146.3Exon 1GCACAUGACGGAGGUUGUGGUUUUAGAGCUAUGCUGUUUUG
sgRNA317 589–17 6084141.4Exon2UCGGAUAAGAUGCUGAGGAGUUUUAGAGCUAUGCUGUUUUG
FAM6-tracr6942.0N/A[FAM6]AAACAGCAUAGCAAGUUAAAAUAAGGCUAG
UCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU
  • *Targeted exons are numbered according to transcript variant 7 of TP53 (NM_001276699.1).

  • GC, guanine and citosine.