Article Text

Download PDFPDF
Antigens of persistent Chlamydia pneumoniae within coronary atheroma from patients undergoing heart transplantation
  1. Nicole Borel1,
  2. Andreas Pospischil1,
  3. Robert D Dowling2,
  4. Claudia Dumrese3,
  5. Charlotte A Gaydos4,
  6. Sebastian Bunk5,
  7. Corinna Hermann5,
  8. Julio A Ramirez6,
  9. James T Summersgill6
  1. 1Institute of Veterinary Pathology, Vetsuisse Faculty, University of Zurich, Zurich, Switzerland
  2. 2Department of Surgery, Division of Cardiothoracic Surgery, University of Louisville, School of Medicine, Louisville, Kentucky, USA
  3. 3Center for Microscopy and Image Analysis, University of Zurich, Zurich, Switzerland
  4. 4Department of Medicine, Division of Infectious Diseases, Johns Hopkins University, Baltimore, Maryland, USA
  5. 5Department of Biochemical Pharmacology, University of Konstanz, Konstanz, Germany
  6. 6Department of Medicine, Division of Infectious Diseases, University of Louisville, School of Medicine, Louisville, Kentucky, USA
  1. Correspondence to Dr Nicole Borel, Institute of Veterinary Pathology, Winterthurerstrasse 268, CH-8057 Zurich, Switzerland; n.borel{at}access.uzh.ch

Abstract

Aims In order for Chlamydia pneumoniae to play a causative role in chronic human disease, it would need to persist within infected tissue for extended periods of time. Current theory suggests that C pneumoniae may persist at the site of infection via an alternative replicative form, known as an aberrant body.

Methods A panel of C pneumoniae-specific antibodies upregulated by the aberrant body was used to probe tissue specimens from the coronary atheroma from 13 explanted hearts to identify patterns of reactivity in these tissues, as well as to determine the presence and prevalence of C pneumoniae aberrant bodies.

Results Six of 13 patients had an ischaemic cardiomyopathy secondary to coronary atherosclerosis, while another six patients had an idiopathic, dilated cardiomyopathy. One additional patient, a young (24 years) woman with cardiomyopathy, had no history of atherosclerotic disease. Eleven patients were positive by immunohistochemistry with at least one antibody. Coronary arteries of the two other patients were negative by immunohistochemistry with all antibodies. One of these patients was the 24-year-old woman with grade I disease and no risk factors for coronary artery disease.

Conclusions The protein antigens of persistent C pneumoniae infection found in the atheromatous lesions from patients in this study could potentially be used as markers to detect such infections and some may be virulence factors or immunogens specific to C pneumoniae, thus serving as target molecules for diagnostic use or therapeutic intervention.

  • Atherosclerosis
  • bacteriology
  • cardiovascular
  • chlamydia
  • Chlamydia pneumoniae
  • coronary atheroma
  • heart transplantation
  • immunohistochemistry
  • persistence
  • virulence factors

Statistics from Altmetric.com

Request Permissions

If you wish to reuse any or all of this article please use the link below which will take you to the Copyright Clearance Center’s RightsLink service. You will be able to get a quick price and instant permission to reuse the content in many different ways.

Chlamydia pneumoniae is an obligate intracellular pathogen that causes acute and chronic respiratory infections in humans.1–4 Over the past decade, a significant amount of data has suggested a role for C pneumoniae in chronic human disease, in particular, atherosclerosis; however, a direct causal role remains to be established.5 In order for C pneumoniae to play a causative role in chronic human disease, it would need to persist within infected tissue for extended periods of time. One hypothesis suggests that C pneumoniae persists at the site of infection via an alternative replicative form, known as an aberrant body defined as a viable but non-cultivable form of chlamydiae.6 These aberrant bodies may represent the mechanism by which this organism persists and causes the chronic inflammatory-type infections characteristic of C pneumoniae and other chlamydiae. In vitro, alterations of the normal developmental cycle of C pneumoniae can be induced.7 Although these in-vitro models of persistence have been characterised in detail, convincing evidence for the in-vivo existence and prevalence of C pneumoniae aberrant bodies is lacking. Demonstration of a high prevalence of aberrant bodies in chronically infected human tissue would establish this form of C pneumoniae as a likely participant in the pathogenesis of disease.

Chlamydial aberrant bodies have been shown to exist in vitro,7 and we have detected aberrant body-like structures of Chlamydia suis in infected pigs.8 We have also identified evidence of persistent C pneumoniae in the atheroma of patients with coronary artery disease (CAD) by tissue microarray and immunogold electron microscopy;9 10 however, these data were collected on archived specimens. Therefore, we conducted a prospective examination of human atheromatous tissue from explanted hearts of patients receiving heart transplants.

The objective of this study was to use a panel of C pneumoniae-specific antibodies, the majority of which are reactive to antigens upregulated in the persistent state of the organism, to probe tissue specimens from the coronary arteries from explanted hearts to identify patterns of reactivity in these tissues, as well as to determine the presence and prevalence of C pneumoniae aberrant bodies. Antibodies directed against chlamydial proteins upregulated during the persistent stage in vitro (lipopolysaccharide (LPS)/major outer membrane protein (MOMP), GroEL and GroES) and suitable to screen atheromatous samples in vivo9 10 were applied in the present study. In addition, recently described antibodies11 12 against other chlamydial proteins such as incA, cpaf and HtrA were used to investigate coronary artery specimens. Immunohistochemistry examinations were complemented by a thorough investigation of adjacent coronary artery tissue specimens by histopathology, culture, PCR and immunogold electron microscopy. Patient sera were investigated by microimmunofluorescence and western blot with the idea of finding a correlation between direct antigen or DNA detection and antibody reaction.

Methods

Patients

Explanted hearts from 13 patients (IDL-01–IDL-13) seeking heart transplantation were investigated. This study was approved by the University of Louisville Institutional Review Board and the required informed consent was obtained for each patient. Medical records from each patient were analysed for: demographics: sex, age at transplantation date; past medical history: neoplastic disease (active or within the past year), congestive heart failure, cerebrovascular disease, renal disease/chronic renal failure, liver disease/cirrhosis, neurological diseases/mental illness, history of community-acquired pneumonia, chronic obstructive pulmonary disease; selected laboratory findings: homocysteine levels, C-reactive protein; established risk factors for atherosclerosis and cardiovascular events: family history of CAD, active CAD, essential arterial hypertension, hyperlipidaemia, previous myocardial infarction, previous angioplasty/bypass surgery/pacemakers, atrial fibrillation, history of smoking, history of alcoholism, diabetes; previous cardiovascular medications: aspirin, beta-blockers, ACE inhibitors, anticoagulants (heparin, warfarin), antiplatelets other than aspirin, statins; and antibiotic treatment received within the 30 days before transplantation. The age range of 12 patients at the transplantation date was 47.1–70.2 years. A single patient was 24 years old. There were two female and eleven male patients. In total, eight patients (IDL-01, IDL-04, IDL-06, IDL-07, IDL-08, IDL-09, IDL-10, IDL-12) were on a left ventricular assistant device (LVAD). Of these, five patients (IDL-01, IDL-06, IDL-07, IDL-08, IDL-09) had recurrent drive line infections and were treated with antibiotics within 30 days before transplant. Pseudomonas aeruginosa was detected in IDL-08 and methicillin-resistant Staphylococcus aureus in IDL-09. For the three other patients, neither the organism(s), nor the antibiotics used for treatment, was recorded. Aminoglycosides, fluorquinolones, rifamycins, tetracyclines and linezolid was used for antibiotic treatment in these two patients.

Previous antibiotic treatment was recorded in five patients (IDL-01, IDL-06, IDL-07, IDL-08, IDL-09). Antibiotic treatment was needed due to line infections of LVAD in all five patients.

Histopathology

At least two pieces of the left and right coronary arteries were collected from the excised tissue samples and immediately fixed in 4% buffered formalin. Each was routinely processed and stained with H&E. Atheroma grading was performed by a cardiac pathologist and was assigned a grade I–V occlusion score.

Antibodies

Antibodies directed against C pneumoniae-specific proteins are shown in table 1. All formalin-fixed, paraffin-embedded coronary artery specimens were screened by immunohistochemistry with each antibody. Based on the immunohistochemistry results and results obtained in previous studies,9 10 the Chlamydiaceae-family specific antibody directed against the LPS and MOMP (LPS/MOMP antibody; Cygnus Technologies, Inc., Southport, North Carolina, USA) was selected for immunogold electron microscopy labelling.

Table 1

Antibodies used for immunohistochemistry and immunogold labelling

Immunohistochemistry

Formalin-fixed, paraffin-embedded sections were stained with the panel of primary antichlamydial antibodies as in table 1 and detection was performed with the detection kit (Dako ChemMate, Glostrup, Denmark) according to the manufacturer's instructions. The optimal dilution for each antibody was previously determined on HEp-2 cell monolayers infected with C pneumoniae for 72 h.

Antigen retrieval was performed by 20 min pressure cooking with HIER target retrieval solution (pH 6,0; target retrieval solution (×10); Dako ChemMate) for all antibodies. For inhibition of the endogenous peroxidase activity, the slides were immersed in peroxidase-blocking solution (Dako ChemMate) for 5 min at room temperature (RT). Two additional blocking solutions were added to the slides, which were incubated with the polyclonal antibodies GroEL and GroES: Dako protein block serum-free for 5 min at RT (Dako ChemMate) and 20 min avidin D solution followed by 20 min biotin solution at RT (Vector Laboratories Inc., Burlingame, California, USA). The slides were then incubated with the primary antibody for 60 min (LPS/MOMP, incA, cpaf, HtrA) or over night (GroEL, GroES) at RT in a moist chamber. Following that, the sections were incubated for 20 min at RT with the link antibody, developed in 3-amino, 9-ethyl-carbazole substrate solution for 10 min at RT and counterstained with haematoxylin. By using the antibody diluent instead of the primary antibody a negative control of each section was performed. Positive controls consisted of HEp-2 cells infected with C pneumoniae for 72 h. Patients with at least one positive localisation per antibody were defined as positive.

Transmission electron microscopy

Glutaraldehyde-fixed coronary artery specimens were post-fixed in osmium tetroxide and then embedded in epon. Appropriate areas for ultrastructural investigation were selected using semi-thin sections (1 μm) stained with toluidine blue (Fluka, Buchs SG, Switzerland). Ultra-thin sections (80 nm) for transmission electron microscopy (TEM) were mounted on gold grids (Merck Eurolab AG, Dietlikon, Switzerland), contrasted with uranyl acetate dihydrate (Fluka) and lead citrate (lead nitrate and tri-natrium dihydrate; Merck Eurolab AG) and examined for the presence of chlamydial developmental stages in an electron microscope (Philips CM10).

Immunogold electron microscopy labelling

For immunogold electron labelling, sections were labelled with the primary antibody LPS/MOMP at a dilution of 1:500 at RT overnight. After washing with PBS/TBS buffer for 30 min, samples were incubated with a 18-nm colloidal gold-conjugated polyclonal IgG anti-rabbit secondary antibody (dilution 1:15) for 2 h. The sections were then washed for another 20 min, rinsed with deionised water and contrasted as described.10 Uninfected and infected (72 h) HEp-2 cell pellets were used as negative and positive controls, respectively.

Culture

Culture was performed at two laboratories in HEp-2 cell monolayers using standard methods. In brief, patient samples were mechanically disrupted and centrifuged at 1000g onto subconfluent HEp-2 cell monolayers for 1 h in serum-free MEM–Eagles medium (Invitrogen, Carlsbad, California, USA) in 24-well plates. Subsequently, MEM–Eagles, containing 10% FBS and 2 μg/ml cycloheximide, was added. Following 72 h of incubation at 37°C, the entire contents of each well were harvested and sonicated for 5 min at 4°C. This was divided into two wells of a 24-well plate and inoculation was carried out as described above. Immunofluorescence microscopy was carried out on the contents of one well using the Pathfinder chlamydia culture confirmation system (BioRad, Hercules, California, USA). The remaining well was passaged into two new wells after 72 h of additional incubation.

DNA extraction and PCR

PCR was as performed at two separate laboratories. Before PCR, tissue specimens from coronary atheroma in M4 transport medium were processed for DNA extraction using a commercial DNA extraction kit (DNeasy tissue kit; Qiagen, Hilden, Germany).

At one site, a real-time PCR was conducted on an ABI 7500 instrument (Applied Biosystems, Foster City, California, USA) using a modified version of the procedure of Everett et al.13 This 23S-based Chlamydiaceae family-specific real-time PCR, as described previously,14 includes primers Ch23S-F (5′–CTGAAACCAGTAGCTTATAAG CGGT–3′), Ch23S-R (5′–ACCTCGCCGTTTAACTTAACTCC–3′), and probe Ch23S-p (FAM–CTCATCA TGCAAAAGGCACGCCG–TAMRA) and yields a 111-bp product specific for members of the family Chlamydiaceae. In each reaction, 2.5 μl of extracted DNA was added to a mix of reagents containing 12.5 μl of 2× TaqMan Fast Universal PCR Master Mix (Applied Biosystems, Darmstadt, Germany), with a final concentration of 5 pmol/μl of each primer and the probe (Microsynth, Balgach, Switzerland) to yield a final volume of 25 μl. The cycling profile included initial denaturation (95°C, 10 min) followed by 45 cycles of denaturation at 94°C for 15 s and 60°C for 60 s. A cycle threshold (Ct value) of less than 38.00 was considered positive, and all samples were tested at least in duplicate.

At the second site, a real-time multiplex PCR with three probes that can detect Chlamydia trachomatis, C pneumoniae and Chlamydia psittaci was used.15

Microimmunofluorescence

Serum samples were collected immediately before heart transplantation from all patients. Blood samples were centrifuged (3000g, 10 min) and sera were stored at −80°C before testing. IgG and IgM antibody titres were determined by microimmunofluorescence using commercial kits (Focus Diagnostics, Cypress, California, USA) according to the manufacturer's instructions.

Western blot

In a previous study,16 the serological response to novel C pneumoniae antigens associated with persistent C pneumoniae infections was characterised. According to these results, the molecular chaperone Hsp70 (DnaK), the RNA polymerase α-chain (RpoA) and the hypothetical protein CpB0704 were found to be immunodominant and thus selected to test human sera from the 13 transplanted patients. Serum reactivity towards RpoA, DnaK and the hypothetical protein CpB0704 was analysed as described previously.17 In brief, the recombinant proteins were separately applied to sodium dodecyl sulphate polyacrylamide gel electrophoresis followed by electroblotting onto Bio Trace NT nitrocellulose membranes (Pall, Port Washington, New York, USA). The membranes were blocked using 5% non-fat dry milk, cut into strips of 4 mm width, of which each was incubated with a serum sample of the 13 donors at a dilution of 1:1000. After four subsequent washing steps, the strips were incubated with a peroxidase-conjugated rabbit anti-human IgG antibody (1:2000 dilution; DakoCytomation) for 45 min followed by another four washing steps. Immunoreactive bands were visualised and quantified by enhanced chemiluminescence detection using a LAS-3000 imaging system (Fuji) and the AIDA software package (Raytest/Fuji). An intensity threshold of 1000 counts above the background level was used as the cut-off.

Results

Detailed results of individual patients are shown in table 2. Six of 13 patients had an ischaemic cardiomyopathy secondary to coronary atherosclerosis (IDL-01, IDL-02, IDL-06, IDL-07, IDL-10, IDL-11), while another six patients had an idiopathic, dilated cardiomyopathy (IDL-04, IDL-05, IDL-08, IDL-09, IDL-12, IDL-13). One patient, a young (24-year-old) woman (IDL-03), had no history of atherosclerotic disease. All patients were free of neoplastic disease (active or within the last year before transplantation), cerebrovascular disease (ie, previous stroke), renal diseases other than chronic renal failure, neurological diseases/mental illness and liver disease/cirrhosis. In contrast, all patients (n=13) had congestive heart failure and nine out of 13 patients had chronic renal failure. Three patients had a previous history of community-acquired pneumonia (IDL-06, IDL-07, IDL-08) and five patients had chronic obstructive pulmonary disease (IDL-5, IDL-06, IDL-08, IDL-12, IDL-13), respectively. Several patients had risk factors for cardiovascular events, including: family history of CAD (n=8), active CAD (n=11), hyperlipidaemia (n=11), arterial hypertension (n=10), previous myocardial infarction (n=10), history of smoking (n=10), diabetes (n=9), atrial fibrillation (n=7), or history of alcoholism (n=1). Previous cardiac surgery was performed in five patients (IDL-02, IDL-06, IDL-07, IDL-10, IDL-11).

Table 2

Details of selected results in heart transplantation patients IDL-01 to IDL-13

Homocysteine levels were elevated in 11 patients (ranged from 4.4 to 23.5 μmol/l, mean value 14.4 μmol/l) and not determined in two patients (IDL-01, IDL-12). C-reactive protein was high in a single patient (12.1 mg/dl, patient IDL-07), but was not tested in all other patients. Cardiovascular medications received within 30 days before transplantation included: aspirin (n=8), beta-blockers (n=12), ACE inhibitors (n=7), anticoagulants (n=11), antiplatelets (n=6) and statins (n=8). Previous antibiotic treatment was recorded in five patients (IDL-01, IDL-06, IDL-07, IDL-08, IDL-09). Antibiotic treatment was needed due to line infections of LVAD in all five patients. Results regarding chlamydial infections were not different between patients with line infections and antibiotic treatment and patients with non-infected LVAD or without LVAD.

All 13 patients exhibited atherosclerotic lesions in their coronary arteries (grades I–V). One patient (IDL-03) had minimal atherosclerotic lesions (grade I). Four patients had between grades II and III (40–70% occlusion), six patients showed grade IV lesions (80–95% occlusion) and grade V (100% occlusion) was seen in two patients.

Representative positive immunohistochemistry labelling with the antibodies LPS/MOMP, GroES, incA and HtrA on patient coronary specimens, in comparison with infected HEp-2 cell pellets, is shown in figure 1. Coronary arteries of two patients were negative by immunohistochemistry with all antibodies (IDL-03, IDL-09). One of these patients was the 24-year-old woman (IDL-03) with grade I disease and no risk factors for CAD. All other 11 patients were positive by immunohistochemistry with at least one antibody. Likewise, all 11 patients showed positive reactions in at least one tissue specimen with the LPS/MOMP antibodies, 10 patients were positive by the GroEL antibody and nine patients revealed positive labelling with the GroES, incA and HtrA antibodies. Only three patients were positive with the cpaf antibody.

Figure 1

Comparative immunohistochemistry results of HEp-2 cells (left panel) and of patient tissue (right panel). Coronary artery specimens from patient number 1 (IDL-1) and patient number 4 (IDL-4) are shown. Antibodies against the lipopolysaccharide and the major outer membrane protein of the family Chlamydiaceae (LPS/MOMP), the heat-shock protein GroES, the inclusion membrane protein incA, and the DO serine protease HtrA were used. Positive labelling with the respective antibodies is present intracytoplasmic in chlamydial inclusions in HEp-2 cells (left panel) and intracytoplasmic and granular in macrophages and smooth muscle cells of coronary arteries of heart transplant patients (right panel).

A rigorous examination of a minimum of four grids for each tissue specimen, for a total of 52 grids, by TEM and immunogold electron microscopy using the LPS/MOMP antibody failed to detect the presence of any normal (elementary, intermediate and reticulate bodies) or altered replicative state of C pneumoniae, including aberrant bodies (data not shown).

Culture and PCR for C pneumoniae was negative in all 13 patients in both laboratories (data not shown).

All 13 patient sera were negative for IgM antibodies by microimmunofluorescence (data not shown). IgG titres were lower (n=2) or equal (n=2) to 1:64, or higher: 1:128 (n=1), 1:256 (n=7) and highest in patient IDL-08 (1:512). Western blot analysis of sera showed positive results for RpoA (n=3), DnaK (n=2) or both (n=6). Only three sera showed reactivity to the hypothetical protein CpB0704.

Discussion

Atheromatous tissues from patients with grades III–V pathology demonstrated reactivity to antibodies to C pneumoniae proteins that are upregulated in models of in-vitro persistence. One young patient, who could conceivably be viewed as a ‘negative control’ in this study, showed no reactivity to any of the serum antibodies tested. This patient was transplanted due to cardiomyopathy at a very young age and also had no risk factors for CAD. Eleven of the 12 other patients showed a variable degree of reactivity with one or more of the antibodies tested, indicating the presence of these antigens within the atherosclerotic lesions of these patients. These chlamydial antigens could be responsible for triggering inflammatory responses in a receptor-dependent manner in the absence of replicating chlamydial organisms. Furthermore, ongoing inflammatory and necrotic processes in chronically infected atherosclerotic lesions can co-stimulate pattern recognition receptors by danger-associated molecular patterns. Although, in the light of negative culture results in all 13 patients, it is possible that C pneumoniae antigens persisted in chronically infected coronary atheroma in the absence of normal replication. The persistence of C pneumoniae antigens rather than viable bacteria has been reported in the literature in vitro and in vivo.18 19 As observed in our study, Meijer et al19 found a granular staining pattern for MOMP, hsp60 and LPS in infected mice by immunohistochemistry instead of visible inclusions. The granular staining pattern of antigens in the absence of staining for DNA by in-situ hybridisation was caused by non-viable bacteria as stated by the authors, and these findings are in accordance with negative PCR and culture results but positive labelling for different chlamydial proteins in the majority of the heart transplantation patients. Furthermore, rapid degradation of DNA in atherosclerotic lesions but persistence of LPS and MOMP in the vessel walls as reported by Meijer et al18 could support our results.

By immunohistochemistry, antibodies against chlamydial proteins whose increased expression has been demonstrated in in-vitro models of persistence7 were applied to detect persistent infections. Antibodies against LPS/MOMP, GroEL and GroES were suitable to detect aberrant bodies of C pneumoniae by immunohistochemistry and immunogold electron microscopy in two previous studies on archived material,9 10 and similarly showed positive labelling in the majority of patients in the present study. By proteomic analyses, MOMP and heat shock proteins such as GroEL and GroES have been shown to be upregulated in various induced persistence models of C pneumoniae20 21 and these findings were confirmed by our study of coronary artery samples.

The chlamydial protease-like activity factor (cpaf) is a major factor of chlamydial pathogenicity, Chlamydia-associated cell damage and inflammation,22 and has different localisations in the cell depending on acute or persistent C pneumoniae infection.23 Antibodies to cpaf have been detected in women with C trachomatis cervicitis24 and may promote C trachomatis persistence.25 In addition, the highest increase in serum reactivity in C pneumoniae-positive donors was found towards cpaf in a recent study16 implicating cpaf as a persistence marker candidate. However, only three patient specimens were positive for cpaf by immunohistochemistry, and preliminary experiments by western blot showed few positive serum samples (data not shown), thus cpaf seems not to be strongly expressed in C pneumoniae persistence in vivo. In contrast, the antibody against HtrA reacted positive in nine patients comparable to the labelling with the LPS/MOMP, GroEL and GroES antibodies. HtrA is a virulence and stress response periplasmic serine protease and molecular chaperone and is upregulated during C trachomatis persistence in vitro.11 26 Chlamydial chaperone proteins such as HtrA, GroEL and GroES may be used as a panel marker to detect persistent C pneumoniae infections in vivo. The regulation of the incA protein, an effector protein secreted by the chlamydial type III secretion system,27 under chlamydial persistence has not been reported so far, but positive labelling in nine out of 13 patients indicate its possible expression during chlamydial persistence.

A rigorous and labour-intensive examination by TEM and immunogold electron microscopy failed to reveal the presence of any normal or altered replicative forms of C pneumoniae, including aberrant bodies. One conclusion would be that there are indeed no aberrant bodies to be found in any of these tissue specimens or patients, and that a larger group of patients would need to be examined. However, this would go against the theory of a relatively high prevalence of aberrant bodies participating in the atherogenic response in humans. The possibility exists that aberrant bodies are present and prevalent in human coronary atheroma, but that a more complete TEM and immunogold electron microscopy examination is needed. By immunogold electron microscopy, intracellular, atypical, round to oval structures of variable diameter resembling reticulate bodies of chlamydia, located within smooth muscle cells, macrophages or fibroblasts, were described in a previous study10 on atherosclerotic tissue from five patients seeking heart transplantation. The absence of typical chlamydial inclusions and their developmental forms (elementary and reticulate bodies) and the presence of necrotic cellular debris mixed with lipids and calcified material made it demanding to screen TEM sections and limits the screening for chlamydial structures by TEM and immunogold electron microscopy. Admittedly, one ultra-thin section only reveals a very small area of the entire atheroma, leaving many areas of the atheroma unscreened. A thorough investigation of the whole complete area of the coronary artery specimens was not possible in this study due to time and cost restraints.

Selected C pneumoniae proteins with antigenic properties, such as RpoA, DnaK and the hypothetical protein CpB0704, were used to test patient sera by western blot. Of these, the highest increase in serum reactivity of PCR-positive donors was found towards RpoA in a previous study.16 This protein was reported to be the most upregulated protein during IFN-γ-mediated in-vitro persistence.21 Consistent with the finding of increased expression of RpoA under persistence were the positive results towards this protein in nine out of 13 heart transplantation patients by western blot in our study. Corresponding immunohistochemistry results on patient tissue specimens were lacking due to the unavailability of an antibody against the RpoA protein. The molecular chaperone Hsp70 (DnaK), another strongly upregulated protein under in-vitro persistence, was one of the immunodominant proteins used for screening of patient sera resulting in eight positive samples. In contrast to RpoA, seroreactivity to DnaK was not significanlty increased in the sera of PCR-positive donors in the immunoproteomic identification study.16 However, results in our study were comparable for these two proteins. This could be explained by distinct antibody response patterns towards persistence-associated C pneumoniae antigens in vivo, as shown by the variable presence or absence of dual IFN-γ and IL-2-producing T-cell responses among C pneumoniae-seropositive individuals.17 Only three patient sera showed reactivity to the hypothetical protein CpB0704 that was previously described to have unaltered seroreactivity among persistently infected patients.16 Generating antibodies against RpoA and DnaK for their use in immunohistochemistry on atheromatous tissues is planned for comparative studies on tissues and serum samples.

Conclusion

In summary, the various antigens of persistent C pneumoniae infection found in atheromatous lesions in this study could potentially be used as markers to detect such infections. Some of these may be virulence factors or immunogens specific to C pneumoniae, thus serving as target molecules for diagnostic use or therapeutic intervention.

Take-home messages

  • This paper describes a detailed, prospective investigation on the prevalence and expression of a panel of chlamydial proteins in coronary artery tissue specimens of 13 human heart transplantation patients.

  • Immunohistochemistry examinations were complemented by a thorough investigation of coronary artery tissue specimens by histopathology, culture, PCR and immunogold electron microscopy.

  • The specificity and suitability of the antibodies for immunohistochemistry was shown in previous studies.9 10

  • Patient sera were investigated by microimmunofluorescence and western blot with the idea of finding a correlation between direct antigen or DNA detection and antibody reaction.

  • The aim of this study was to find markers to detect and diagnose persistent chlamydial infections in patients with atherosclerosis.

  • A panel of C pneumoniae-specific antibodies upregulated by the aberrant body was suitable to detect such infections and could serve as diagnostic markers in the future.

References

Footnotes

  • Collaborating investigators: R Nakamatsu, M Allen, F Arnold and P Peyrani, University of Louisville, Louisville, Kentucky; D Ackermann, Department of Pathology, Jewish Hospital, Louisville, Kentucky; G Zhong, University of Texas, San Antonio, Texas; P Timms, W Huston, Queensland University of Technology, Brisbane, Australia; U Ziegler, University of Zurich, Zurich, Switzerland; S von Aulock, University of Konstanz, Konstanz, Germany; C Kaiser, L Nufer, Institute of Veterinary Pathology, University of Zurich, Switzerland.

  • Funding This study was supported by grants from the American Heart Association (JTS) and the Bodenseehochschulförderung (NB, AP, SvA, CH, SB). Grant number AHA 0755338B, IBH 530/08.

  • Competing interests None.

  • Patient consent Obtained.

  • Ethics approval This study was approved by the University of Louisville Institutional Review Board.

  • Provenance and peer review Not commissioned; externally peer reviewed.