Table 1 Primer sequences used for PCR amplification of epidermal growth factor receptor (EGFR)* exons 18, 19, 20 and 21
Exon (base pairs)Sequence (5′–3′)
18 (186)
    ForwardCTGAGGTGACCCTTGTCTCTGTGTTCTT
    ReverseAGAGGCCTGTGCCAGGGACCTTA
19 (204)
    ForwardGCATGTGGCACCATCTCACAA
    ReverseCCTGAGGTTCAGAGCCATGGA
20 (248)
    ForwardCCATGCGAAGCCACACTGA
    ReverseCGTATCTCCCTTCCCTGATTACC
21 (236)
    ForwardGCAGAGCTTCTTCCCATGATGA
    ReverseGCTGACCTAAAGCCACCTCCT
  • *Genbank accession number NT_079592.