Table 2

EGFR and KRAS primer sequences used for HRM analysis

GenePrimer sequence 5′–3′Amplicon
EGFR EX19Fw CGTCTTCCTTCTCTCTCTGTC190 bp
Rev GACATGAGAAAAGGTGGGC
EGFR EX 21Fw GCATGAACTACTTGGAGGAC142 bp
Rev GGCTGACCTAAAGCCAC
K-RAS EX 2Fw GGCCTGCTGAAAATGACTGAAT172 bp
Rev TCAAAGAATGGTCCTGCACC
  • Fw, forward primer; Rev, reverse primer.