Table 3

Primer sequences used for the PDM, MSD and SSD reactions

GenePrimer sequenceProduct size (bp)Predicted Tm (°C)
KRAS E2 outerF: TGAATATAAACTTGTGGTAGTTGG174NA
R: GCTGTATCGTCAAGGCACTCT
KRAS E2 innerF: ATATAAACTTGTGGTAGTTGGAG6284.1
R: TATCGTCAAGGCACTCTTGC
KRAS E3 outerF: CCAGACTGTGTTTCTCCCTTC152NA
R: AAAGAAAGCCCTCCCCAGT
KRAS E3* innerF: TGTGTTTCTCCCTTCTCAGGA14586.3
R: AAGAAAGCCCTCCCCAGT
KRAS E4 outerF: AGACACAAAACAGGCTCAGGA160NA
R: TTGAGAGAAAAACTGATATATTAAATGAC
BRAF E15 outerF: ATCTACTGTTTTCCTTTACTTACTACAC205NA
R: CAGCATCTCAGGGCCAA
PIK3CA E1 outerF: CACGACCATCATCAGGTGAA168NA
R: GGAGGGGGTATTTTCTTGCT
PIK3CA E9 outerF: CTGTGAATCCAGAGGGGAAA197NA
R: GCACTTACCTGTGACTCCATAGAA
PIK3CA E20 outerF: TGAGCAAGAGGCTTTGGAGT201NA
R: CCTATGCAATCGGTCTTTGC
PIK3CA E20 innerF: GCAAGAGGCTTTGGAGTATTTC11581.9
R: TTTTCAGTTCAATGCATGCTG
PTEN E3 outerF: TCATTTTTGTTAATGGTGGCTTT182NA
R: ACTCTACCTCACTCTAACAAGCAGA
PTEN E3 innerF: GGCTTTTTGTTTGTTTGTTTTG15878.4
R: CCTCACTCTAACAAGCAGATAACTTTC
PTEN E5A outerF: GGTTATCTTTTTACCACAGTTGCAC118NA
R: GATTGTCATCTTCACTTAGCCATT
PTEN E7 outerF: GTTCCCTCAGCCGTTACCT191NA
R: CACCTGCAGATCTAATAGAAAACAA
NRAS E2 outerF: GGTTTCCAACAGGTTCTTGC191NA
R: TCCGACAAGTGAGAGACAGG
NRAS E2 innerF: TACAAACTGGTGGTGGTTGG11586.6
R: CACTGGGCCTCACCTCTATG
  • *These primers were tailed and used for the MSD reactions. The outer and inner primers were designed using Primer3 as previously described.6 These primers have also been used in previous studies.6 The KRAS exon 3 and BRAF exon 15 tailed primers were used for the MSD reactions.

  • MSD, multiplex specific diagnostic; NA, not applicable; PDM, prediagnostic multiplex; SSD, single specific diagnostic.