Table 2

List of PCR primers used to demonstrate how to achieve adequate separation of Tms of multiplex targets

GenePrimer sequenceProduct size (bp)Predicted Tm (°C)
KRAS E2 innerF: ATATAAACTTGTGGTAGTTGGAG6284.1
R: TATCGTCAAGGCACTCTTGC
KRAS E3 tailedF: cccgggcgggccggcccCTTGGATATTCTCGACACAGCA8592.0
R: cccgggcgggccggcccTCCCTCATTGCACTGTACTCCT
KRAS E4 innerF: TGGAATTCCTTTTATTGAAACATC5675.1
R: TTTCAGTGTTACTTACCTGTCTTGTCT
BRAF E11 innerF: TGGGCAGATTACAGTGGGA6879.6
R: GCCACTTTCCCTTGTAGACTG
BRAF E15 tailedF: gggccggcccTTCATGAAGACCTCACAGTAAA9085.9
R: gggccggcccGACCCACTCCATCGAGAT
  • The tailed primers for KRAS exon 3 and BRAF exon 15, as well as other primers used for the optimisation of the MSD reactions, were ‘manually’ designed using a combination of UCSC in silico PCR and MFEprimer web-based software.13 ,14

  • MSD, multiplex specific diagnostic; Tm, melting temperature.