Table 1

List of PCR primers used for the optimisation of mHRM analysis

 GenePrimer sequenceProduct size (bp)Predicted Tm (°C)
TP53 E8bF: GCCTGTCCTGGGAGAGAC5384.3
R: CCTTTCTTGCGGAGATTCT
TP53 E4dF: GGCAGCTACGGTTTCC8087.8
R: CCCTCAGGGCAACTGA
SMAD4 E9aF: GTATTGGTGTTCCATTGCTTACT5676.9
R: TAAATGTCTCTCCTACCTGAACAT
  • mHRM, multiplex high-resolution melting; Tm, melting temperature.